Sequence of DPV Citrus exocortis Yucatan viroid

Citrus exocortis Yucatan viroid isolate 10, complete genome.

ACC No: FJ751928

Dated: 2009-04-13 | Length: 394 | CRC: -2116574377

                
ID   FJ751928; SV 1; circular; genomic RNA; STD; VRL; 394 BP.
XX
AC   FJ751928;
XX
DT   13-APR-2009 (Rel. 100, Created)
DT   13-APR-2009 (Rel. 100, Last updated, Version 1)
XX
DE   Citrus exocortis Yucatan viroid isolate 10, complete genome.
XX
KW   .
XX
OS   Citrus exocortis Yucatan viroid
OC   Viroids; Pospiviroidae; Pospiviroid.
XX
RN   [1]
RP   1-394
RA   Uc-Varguez A., Moreno-Valenzuela O.A.;
RT   "Molecular characterization of a population of Citrus Exocortis Viroid-Low
RT   sequence similarity (CEVd-LSS), a tentative new citrus viroid isolated in
RT   citrus species in Yucatan, Mexico";
RL   Unpublished.
XX
RN   [2]
RP   1-394
RA   Uc-Varguez A., Moreno-Valenzuela O.A.;
RT   ;
RL   Submitted (13-FEB-2009) to the EMBL/GenBank/DDBJ databases.
RL   UBBMP, Centro de Investigacion Cientifica de Yucatan, 43, Merida, Yucatan
RL   97200, Mexico
XX
FH   Key             Location/Qualifiers
FH
FT   source          1. .394
FT                   /organism="Citrus exocortis Yucatan viroid"
FT                   /isolate="10"
FT                   /mol_type="genomic RNA"
FT                   /PCR_primers="fwd_name: CEVd-F, fwd_seq:
FT                   ccctgaaggacttcttcccc, rev_name: CEVd-R, rev_seq:
FT                   atccccggggaaacctggaggaag"
FT                   /note="similar to mitochondrial small subunit ribosomal
FT                   RNA"
FT                   /db_xref="taxon:596768"
XX
SQ   Sequence 394 BP; 92 A; 100 C; 118 G; 84 T; 0 other;

fj751928 Length: 394  13-APR-2009  Type: N  Check: 8372  ..

       1  atccccgggg aaacctggag gaaggtgggg atgacgtcaa gtccgcatgg
      51  cccttatggg ctgggccaca cacgtgctac aatggcaatt acaatgggaa
     101  gcaaggctgt aaggcggagc gaatccggaa agattgcctc agttcggatt
     151  gttctctgca actcgggaac atgaagttgg aatcgctagt aatcgcggat
     201  cagcatgccg cggtgaatat gtacccgggc cctgtacaca ccgcccgtca
     251  caccctggga attggtttcg cccgaagcat cggaccaatg atcacccatg
     301  acttctgtgt accactagtg ccacaaaggc ttttggtggt cttattggcg
     351  cataccacgg tggggtcttc gactggggaa gaagtccttc aggg