Sequence of DPV Citrus exocortis Yucatan viroid
Citrus exocortis Yucatan viroid isolate 10, complete genome.
ACC No: FJ751928
Dated: 2009-04-13 | Length: 394 | CRC: -2116574377
ID FJ751928; SV 1; circular; genomic RNA; STD; VRL; 394 BP.
XX
AC FJ751928;
XX
DT 13-APR-2009 (Rel. 100, Created)
DT 13-APR-2009 (Rel. 100, Last updated, Version 1)
XX
DE Citrus exocortis Yucatan viroid isolate 10, complete genome.
XX
KW .
XX
OS Citrus exocortis Yucatan viroid
OC Viroids; Pospiviroidae; Pospiviroid.
XX
RN [1]
RP 1-394
RA Uc-Varguez A., Moreno-Valenzuela O.A.;
RT "Molecular characterization of a population of Citrus Exocortis Viroid-Low
RT sequence similarity (CEVd-LSS), a tentative new citrus viroid isolated in
RT citrus species in Yucatan, Mexico";
RL Unpublished.
XX
RN [2]
RP 1-394
RA Uc-Varguez A., Moreno-Valenzuela O.A.;
RT ;
RL Submitted (13-FEB-2009) to the EMBL/GenBank/DDBJ databases.
RL UBBMP, Centro de Investigacion Cientifica de Yucatan, 43, Merida, Yucatan
RL 97200, Mexico
XX
FH Key Location/Qualifiers
FH
FT source 1. .394
FT /organism="Citrus exocortis Yucatan viroid"
FT /isolate="10"
FT /mol_type="genomic RNA"
FT /PCR_primers="fwd_name: CEVd-F, fwd_seq:
FT ccctgaaggacttcttcccc, rev_name: CEVd-R, rev_seq:
FT atccccggggaaacctggaggaag"
FT /note="similar to mitochondrial small subunit ribosomal
FT RNA"
FT /db_xref="taxon:596768"
XX
SQ Sequence 394 BP; 92 A; 100 C; 118 G; 84 T; 0 other;
fj751928 Length: 394 13-APR-2009 Type: N Check: 8372 ..
1 atccccgggg aaacctggag gaaggtgggg atgacgtcaa gtccgcatgg
51 cccttatggg ctgggccaca cacgtgctac aatggcaatt acaatgggaa
101 gcaaggctgt aaggcggagc gaatccggaa agattgcctc agttcggatt
151 gttctctgca actcgggaac atgaagttgg aatcgctagt aatcgcggat
201 cagcatgccg cggtgaatat gtacccgggc cctgtacaca ccgcccgtca
251 caccctggga attggtttcg cccgaagcat cggaccaatg atcacccatg
301 acttctgtgt accactagtg ccacaaaggc ttttggtggt cttattggcg
351 cataccacgg tggggtcttc gactggggaa gaagtccttc aggg